Skip to content

Latest commit

 

History

History
454 lines (370 loc) · 22.4 KB

File metadata and controls

454 lines (370 loc) · 22.4 KB

scarecrow

Back to root

Example: Parse Evercode WTv2

Parse Evercode WTv2 library structure

Library structure


Prep

Stay organised - create a folder for the project to keep things tidy.

PROJECT=./scarecrow/examples/Parse
mkdir -p ${PROJECT}

Download Evercode WTv2 data from NCBI SRA accession:SRR28867558.

mkdir -p ${PROJECT}/fastq
ACC=SRR28867558
prefetch --output-directory ${PROJECT}/fastq ${ACC}
fasterq-dump ${PROJECT}/fastq/${ACC} -e 2 --split-files --include-technical --force --outdir ${PROJECT}/fastq
gzip ${PROJECT}/fastq/${ACC}_1.fastq # Index
gzip ${PROJECT}/fastq/${ACC}_2.fastq # cDNA sequences
gzip ${PROJECT}/fastq/${ACC}_3.fastq # Barcodes and UMI

1. Identify barcode seeds

This step requires barcode whitelists associated with the assay being used. Parse Bioscience customers can access the whitelists for the different assays by downloading their splitpipe pipeline. The whitelists are csv files in a barcodes directory (e.g. ./software/ParseBiosciences-Pipeline.1.4.1/splitpipe/barcodes/barcode_data_v1.csv). We only require the barcode sequence for scarecrow, so this needs cutting from the file (i.e. cut -d',' -f2 barcode_data_v1.csv | sed '1d' > barcode_data_v1.txt). Once the whitelists are generated, they can be defined as colon-delimited strings (<barcode index>:<whitelist name>:<whitelist file>) in a bash array for later use. For convenience, we have provided in the scarecrow repo the below barcode files

BARCODES=(BC1:n99_v5:${PROJECT}/barcode_whitelists/bc_data_n99_v5.txt
          BC2:v1:${PROJECT}/barcode_whitelists/bc_data_v1.txt
          BC3:v1:${PROJECT}/barcode_whitelists/bc_data_v1.txt)

We can now run scarecrow seed to process each barcode whitelist. The below example is for a SLURM HPC, but will work on a standard PC by omitting the sbatch line. It randomly samples 10k reads from the first 100k in the FASTQ files and records the start positions of barcodes, their orientation, nucleotide frequencies per position, and conserved sequence runs.

mkdir -p ${PROJECT}/barcode_profiles
FASTQS=(${PROJECT}/fastq/*.fastq.gz)
for BARCODE in ${BARCODES[@]}
do
    scarecrow seed \
        --num_reads 10000 \
        --upper_read_count 100000 \
        --fastqs ${FASTQS[@]} \
        --barcodes ${BARCODE} \
        --out ${PROJECT}/barcode_profiles/barcodes.${BARCODE%%:*}.csv
done

The above example uses the default set-based barcode matching method. The alternative is to use the trie-index method which is better suited to much larger barcode whitelists. The indexing method can be either kmer or seed based (see pickle). For comparison purposes, we run both methods here.

FASTQS=(${PROJECT}/fastq/*.fastq.gz)
METHODS=('kmer' 'seed')
for METHOD in ${METHODS[@]}
do
    mkdir -p ${PROJECT}/${METHOD}/barcode_profiles
    for BARCODE in ${BARCODES[@]}
    do
        scarecrow seed \
            --num_reads 10000 \
            --upper_read_count 100000 \
            --fastqs ${FASTQS[@]} \
            --barcodes ${BARCODE} \
            --pickle ${PROJECT}/${METHOD}/barcodes.${BARCODE%%:*}.pkl.gz \
            --index ${METHOD} \
            --out ${PROJECT}/${METHOD}/barcode_profiles/barcodes.${BARCODE%%:*}.csv
    done
done

2. Harvest barcode profiles

The barcode profiles generated by scarecrow seed are gathered with scarecrow harvest to identify the likely barcode index positions. The --barcode_count parameter specifies the number of barcodes to return for each barcode index, and should typically be set to 1 unless debugging. The --min_distance parameter sets the minimum distance required between the end and start positions of two barcodes. The --conserved parameter enables the masking of conserved sequence regions - for instance barcode linker sequences, to prevent barcode positions falling within these regions.

BARCODE_FILES=(${PROJECT}/barcode_profiles/barcodes.*.csv)
scarecrow harvest \
    ${BARCODE_FILES[@]} \
    --barcode_count 1 \
    --min_distance 10 \
    --conserved ${PROJECT}/barcode_profiles/barcodes.${BARCODES[0]%%:*}_conserved.tsv \
    --out ${PROJECT}/barcode_profiles/barcode_positions.csv

Both the set- and trie-index methods are processed in the same manner with harvest. However, to illustrate that the same barcode profiles are generated, we can repeat the above on the trie-index method outputs from seed.

METHODS=('kmer' 'seed')
for METHOD in ${METHODS[@]}
do
    BARCODE_FILES=(${PROJECT}/${METHOD}/barcode_profiles/barcodes.*.csv)
    scarecrow harvest \
        ${BARCODE_FILES[@]} \
        --barcode_count 1 \
        --min_distance 10 \
        --conserved ${PROJECT}/${METHOD}/barcode_profiles/barcodes.${BARCODES[0]%%:*}_conserved.tsv \
        --out ${PROJECT}/${METHOD}/barcode_profiles/barcode_positions.csv
done

The plots generated by harvest indicates that no barcode matches were found on read 1 (SRR28867558_1.fastq.gz), virtually no barcode matches were found on read 2 (SRR28867558_2.fastq.gz), regardless of barcode orientation, while matches were found on read 3 (SRR28867558_3.fastq.gz) in both orientations. The majority of reads returned matches at positions 11, 49, and 79 in forward orientation, which correspond with the positions of the 3 barcodes expected of the assay. An additional peak was identified in a conserved region (highlighted in red) that corresponds with one of the linker sequences of the assay. As this peak falls within a conserved region it is ignored.


Barcode profiles for FASTQ index 1, forward orientation Barcode profiles for FASTQ index 1, reverse orientation
Barcode profiles for FASTQ index 2, forward orientation Barcode profiles for FASTQ index 2, reverse orientation

The regions for the three barcodes (one per whitelist) selected by the harvest are highlighted in blue. These are recorded in the barcode_positions.csv file. Note, file_index is 0-based.

barcode_whitelist,file_index,file,orientation,start,end,read_count,read_fraction
BC2:v1,2,SRR28867558_3.fastq.gz,forward,11,18,8852,0.93
BC3:v1,2,SRR28867558_3.fastq.gz,forward,49,56,8329,0.87
BC1:n99_v5,2,SRR28867558_3.fastq.gz,forward,79,86,7447,0.8

3. Reap sequence data

Now that the barcode positions have been characterised we can extract the target sequence with scarecrow reap. This will also record barcode metadata (sequence, qualities, corrected sequence, positions, mismatches) and UMI data (sequence, quailties). The output can be either SAM format (default) or FASTQ. The range to --extract includes the read index (e.g. 1 or 2) followed by the positional range, and --umi follows the same format to indicate where the UMI sequence is. The --jitter parameter indicates the number of flanking bases to extend the barcode start position by when looking for a match. The --mismatch parameter indicates the maximum number of mismatches permitted when matching the barcode against a whitelist - also known as the edit distance. The --base_quality parameter base quality threshold, below which bases are masked as N, this step occurs before barcode matching and can significantly reduce the number of valid barcodes if set too high. For a fair comparison with the Parse splitpipe workflow we do not apply any base quality masking in this instance.

THREADS=16
JITTER=2
MISMATCH=2
FASTQS=(${PROJECT}/fastq/*.fastq.gz)
OUT=$(basename ${FASTQS[0]%.fastq*})
mkdir -p ${PROJECT}/extracted/J${JITTER}M${MISMATCH}
sbatch -p uoa-compute --ntasks 1 --cpus-per-task ${THREADS} \
    --mem 16G --time=12:00:00 -o reap.%j.out -e reap.%j.err \
    scarecrow reap \
        --threads ${THREADS} \
        --batch_size 20000 \
        --fastqs ${FASTQS[@]} \
        --barcode_positions ${PROJECT}/barcode_profiles/barcode_positions.csv \
        --barcodes ${BARCODES[@]} \
        --extract 2:1-74 --umi 3:1-10 \
        --jitter ${JITTER} \
        --mismatch ${MISMATCH} \
        --out ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT} \
        --out_fastq

(Optional) Check that the read count in the resulting FASTQ file is equal to that of one of the input FASTQ files. This is a basic sanity check to ensure that nothing unexpected happened whilst running scarecrow on the HPC that might have resulted in some I/O issues. Here is an example of counting reads using seqtk and awk on non-interleaved and interleaved FASTQ files.

# A non-interleaved input FASTQ file
seqtk seq ${FASTQS[0]} | awk '/^@/ {c++} END {print c}'
# Interleaved scarecrow FASTQ file
seqtk seq ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}.fastq | awk '/^@/ {c++} END {print c/2}'

In addition to generating an interleaved FASTQ file, scarecrow outputs a JSON file indicating the barcode and UMI positions on read 1, and the parameters required to use the file with the kb count tool of kallisto-bustools. In addition, the tools outputs a _mismatch_stats.csv and a _position_stats.csv file. The mismatch_stats CSV has the following format:

mismatches,count
-3,3814125
-2,3590285
-1,14409173
0,125784335
1,11300683
2,6035706
3,1026087
4,823998
5,391577
6,298803

Indicating the number of reads recorded for each sum of mismatches across its barcodes. For example, allowing up to 2 mismatches for 3 barcodes will sum to 6 if each barcode has 2 mismatches. Negative numbers indicate the number of reads for which no barcode was found (i.e. -1 is one barcode unmatched, -2 is two barcodes unmatched, ...).

The position_stats CSV follows a similar format, indicating the count of barcodes starting at each position within --jitter 1 :

position,count
*,11950
10,3658309
11,154983669
12,1527298
48,9795569
49,146681602
50,2644153
78,13877626
79,133791532
80,2420490
N,33032118

The asterisk (*) position indicates for those barcodes that more than one match for the same barcode sequence was found with the same number of mismatches and distance. In such instances, the barcode and number of mismatches are known however the exact position is not. The position counts shown above illustrate that millions of reads have barcodes not starting at the expected positions.

If using the trie-based method, reap would be run using the pickle indices instead of the whitelists, as follows:

THREADS=16
JITTER=2
MISMATCH=2
FASTQS=(${PROJECT}/fastq/*.fastq.gz)

METHODS=('kmer' 'seed')
for METHOD in ${METHODS[@]}
do
    BARCODES=(BC1:n99_v5:${PROJECT}/${METHOD}/barcodes.BC1.pkl.gz
            BC2:v1:${PROJECT}/${METHOD}/barcodes.BC2.pkl.gz
            BC3:v1:${PROJECT}/${METHOD}/barcodes.BC3.pkl.gz)
    OUT=$(basename ${FASTQS[0]%.fastq*})
    mkdir -p ${PROJECT}/extracted/${METHOD}/J${JITTER}M${MISMATCH}
    sbatch -p uoa-compute --ntasks 1 --cpus-per-task ${THREADS} --mem 64G --time=24:00:00 -o reap.%j.out -e reap.%j.err \
        scarecrow reap \
            --threads ${THREADS} \
            --batch_size 20000 \
            --fastqs ${FASTQS[@]} \
            --barcode_positions ${PROJECT}/${METHOD}/barcode_profiles/barcode_positions.csv \
            --barcodes ${BARCODES[@]} \
            --extract 2:1-74 --umi 3:1-10 \
            --jitter ${JITTER} \
            --mismatch ${MISMATCH} \
            --out ${PROJECT}/extracted/${METHOD}/J${JITTER}M${MISMATCH}/${OUT} \
            --out_fastq
done

The below table summarises the number of mismatches identified at each jitter from 0 to 2, allowing upto 2 mismatches.

Mis Jitter 0 Jitter 1 Jitter 2
-3 6577880 3814125 3433420
-2 9108695 3590285 2325977
-1 18855850 14409173 13060489
0 119851052 125784335 126768927
1 7350721 11300683 12071477
2 3709152 6035706 6885939
3 647834 1026087 1217658
4 832710 823998 993382
5 284521 391577 423432
6 256357 298803 294071

The number of valid barcodes is the sum of those with >=0 mismatches. This can be easily calculated from the mismatch stats file.

OUT=$(basename ${FASTQS[0]%.gz})
awk -F, 'NR>1 && $1 >= 0 {sum += $2} END {print sum}' $PROJECT/extracted/J${JITTER}M${MISMATCH}/${OUT}_mismatch_stats.csv

The below table summarises the number of barcode position matches identified at each jitter from 0 to 2, allowing upto 2 mismatches.

Pos Jitter 0 Jitter 1 Jitter 2
* 11950 13501
9 824455
10 3658309 3599189
11 155509351 154983669 154669696
12 1527298 1449340
13 525384
47 2067460
48 9795569 9485814
49 150818590 146681602 146188365
50 2644153 2350402
51 667344
77 3619040
78 13877626 13545713
79 139289495 133791532 133008992
80 2420490 2252858
81 144060
N 56806880 33032118 28012703

The Parse barcode whitelists have 96 (v1) and 99 (n99_v5) 8-mer barcodes. Given the small size of these whitelists the default set-based method is more efficient, as evident from the SLURM job logs summarised below based on using 16 threads.

Method CPU Utilized CPU Efficiency Wall-clock time Memory Utilized
Set (J0M2) 02:07:31 21.86% 00:36:27 2.68 GB
kmer (J0M2) 11:20:41 77.19% 00:55:07 2.42 GB
seed (J0M2) 04:42:51 32.23% 00:54:51 2.29 GB
Set (J1M2) 03:36:57 33.62% 00:40:20 2.72 GB
kmer (J1M2) 2-11:26:29 96.88% 03:50:05 3.98 GB
seed (J1M2) 12:07:40 83.83% 00:54:15 2.46 GB
Set (J2M2) 04:12:36 40.62% 00:38:52 2.72 GB
kmer (J2M2) 4-09:19:27 98.16% 06:42:22 4.51 GB
seed (J2M2) 18:11:43 91.77% 01:14:21 3.89 GB

4. Sift reads with invalid barcodes

Reads with one or more invalid barcode are uninformative in downstream analyses as they could not be confidently demultiplexed. We can filter these reads out either by using the --sift flag when running reap, or by using the sift tool afterwards. Here we demonstrate sift after running reap. As we are providing a scarecrow FASTQ input we also need to provide the accompanying JSON file. If a scarecrow SAM input is provided then no JSON file is required.

OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}.fastq
sbatch -p uoa-compute --ntasks 1 --mem 2G --time=12:00:00 -o sift.%j.out -e sift.%j.err \
            scarecrow sift --in ${FASTQ} --json ${FASTQ%.fastq}.json

5. Trim TSO sequences

To improve downstream alignment results it is highly recommended to trim the reads to remove and adapter sequences or template switching oligo (TSO) sequences. Not all reads possess these sequences, and those that do will not necessarily share the same start position. There is an updated fastqc contaminants list in the Parse splitpipe repo, which we can format for use with cutadapt and supplement with the Parse TSO sequence AACGCAGAGTGAATGGG. Below illustrates how this was achieved, and for convenience we have included in the scarecrow repo the processed contaminants list. Note, we use the -G rather than the -g flag for cutadapt because the sequence to be trimmed is on the read 2 output by scarecrow, rather than read 1 - which now sotres the barcode and UMI sequences.

CONTAMINANTS=./software/ParseBiosciences-Pipeline.1.4.1/splitpipe/scripts/config/fastqc-contaminant_list.txt
awk '
# Skip blank lines and comment lines
NF && $0 !~ /^#/ {
  seq = $NF
  header = ""
  for (i = 1; i < NF; i++) {
    header = header $i " "
  }
  gsub(/[ \t]+$/, "", header)
  # Use a separate array to track seen sequences
  if (header != "" && !(seq in seen)) {
    seen[seq] = 1
    print ">" header
    print seq
  }
}
' ${CONTAMINANTS} > ${PROJECT}/contaminants.fasta

# Add Parse Bio TSO sequence to contaminants
sed -i '$ a >Parse Bio TSO sequence\nAACGCAGAGTGAATGGG' ./${PROJECT}/contaminants.fasta

OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=$(basename ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_sift.fastq)
sbatch -p uoa-compute --ntasks 1 --cpus-per-task 4 --mem 16G --time=12:00:00 -o cutadapt.%j.out -e cutadapt.%j.err \
    cutadapt --cores 4 --trim-n --minimum-length 30 --interleaved \
        -G file:${PROJECT}/contaminants.fasta \
        -o ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ%_sift.fastq}_trimmed.fastq \
        ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ}

6. Generate barcode statistics

OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.fastq
sbatch -p uoa-compute --ntasks 1 --mem 4G --time=12:00:00 -o stats.%j.out -e stats.%j.err \
            scarecrow stats --in ${FASTQ}

7. Generate count matrix via kallisto-bustools

Next we can generate a count matrix using kallisto. There is a script in the scarecrow repo, kallisto.sh, that parses the JSON file generated by reap to retrieve the -x string required for running the FASTQ file with kb count. This requires the JSON sed-like processor, jq, to be installed. This enables the -x flag to be extracted as follows:

XSTR=$(${jq} -r '."kallisto-bustools"[0]."kb count" | capture("-x (?<x>[^ ]+)").x' ${JSON})

The kallisto.sh script requires the kallisto --index and --genes for the reference assembly in question, in addition to the FASTQ and JSON files generated by scarecrow.

#conda deactivate
#mamba activate kallisto
mkdir -p ${PROJECT}/kallisto/J${JITTER}M${MISMATCH}
OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=$(basename ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.fastq)
sbatch -p uoa-compute --ntasks 1 --cpus-per-task 8 --mem 4G --time=12:00:00 \
    ~/sharedscratch/scarecrow/scripts/kallisto.sh \
        --index /uoa/scratch/users/s14dw4/software/kallisto/hg38/transcriptome.idx \
        --genes /uoa/scratch/users/s14dw4/software/kallisto/hg38/transcripts_to_genes.txt \
        --fastq ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ} \
        --json ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ%_trimmed.fastq}.json \
        --out ${PROJECT}/kallisto/J${JITTER}M${MISMATCH}/${FASTQ%.fastq}

8. Generate count matrix via STAR and umi-tools

Before aligning with STAR, if we wish to incoprorate the barcode and UMI read tags we should first recast the FASTQ file to SAM format.

OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.fastq
sbatch -p uoa-compute --ntasks 1 --mem 2G --time=24:00:00 -o recast.%j.out -e recast.%j.err \
            scarecrow recast --in ${FASTQ}

Next, we align with STAR from scarecow SAM format. For fair comparison with the Parse split-pipe results, we include the --clip3pAdapterSeq used in their pipeline.

/uoa/scratch/users/s14dw4/software/STAR --runThreadN ${SLURM_CPUS_PER_TASK} \
        --genomeDir ${GENOME} \
        --readFilesIn ${SAM} \
        --readFilesType SAM SE \
        --outFileNamePrefix ${OUT}/${ID}. \
        --outSAMtype BAM Unsorted \
        --clip3pAdapterSeq CCACAGTCTCAAGCACGTGGAT \
        --outFilterMultimapNmax 3

The script is run on the HPC as follows:

mkdir -p ${PROJECT}/star/J${JITTER}M${MISMATCH}
OUT=$(basename ${FASTQS[0]%.fastq.gz})
SAM=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.sam
ID=$(basename ${SAM%.sam})
GENOME=/uoa/scratch/users/s14dw4/spipe/genomes/hg38
sbatch -p uoa-compute --ntasks 1 --cpus-per-task 32 --mem 24G --time=02:00:00 -o star.%j.out -e star.%j.err \
    ./scarecrow/scripts/star_align_sam_parse.sh \
        --genome ${GENOME} \
        --sam ${SAM} \
        --out ${PROJECT}/star/J${JITTER}M${MISMATCH}

Next step is to run umi-tools. The reference GTF file we use for this has a slighltly different config naming convention to the reference we used for alignment with STAR. To address this issue we generate an alias file for use with featureCounts from the subread package, see the umi-tools single-cell tutorial for more details. We have included a script in the scarecrow repo, umi_tools.sh which runs featureCounts followed by umi-tools count to generate a counts matrix.

GTF=/uoa/scratch/shared/Morgan_Lab/common_resources/cellranger/reference/refdata-gex-GRCh38-2020-A/genes/genes.gtf
OUT=$(basename ${FASTQS[0]%.fastq.gz})
BAM=${PROJECT}/star/J${JITTER}M${MISMATCH}/*.bam

# Need to create contig look-up as GTF does not have hg38_ prefix to contigs
mkdir -p ${PROJECT}/umi_tools/J${JITTER}M${MISMATCH}
#mamba activate samtools_env
samtools view -H ${BAM} | cut -f2 | grep "^SN" | sed 's/SN://g' | \
    awk '{split($0, TIG, "_"); print TIG[2]","$0;}' > ${PROJECT}/umi_tools/alias.file

# Run UMI-tools
sbatch --partition uoa-compute ./scarecrow/scripts/umi_tools.sh \
    --bam ${BAM} \
    --gtf ${GTF} \
    --out ${PROJECT}/umi_tools/J${JITTER}M${MISMATCH} \
    --alias ${PROJECT}/umi_tools/alias.file

Next, the umi_tools output can be converted to a matrix format for downstream processing in R in a similar manner to the kallisto output.

COUNTS=${PROJECT}/umi_tools/J${JITTER}M${MISMATCH}/*.featureCounts.counts.tsv.gz
sbatch --partition uoa-compute ./scarecrow/scripts/counts2mtx.sh --in ${COUNTS}